3692s (Cell Signaling Technology Inc)
Cell Signaling Technology Inc is a verified supplier 
Cell Signaling Technology Inc manufactures this product 
95
Structured Review
Cell Signaling Technology Inc
3692s
3692s, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 131 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/eef2k/eEF2k+Antibody/bio_rxiv__64898__2026__01__28__701883-380-7-4
Average 95 stars, based on 131 article reviews
3692s, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 131 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/eef2k/eEF2k+Antibody/bio_rxiv__64898__2026__01__28__701883-380-7-4
Average 95 stars, based on 131 article reviews
3692s - by Bioz Stars,
2026-10
95/100 stars
Images
Related Articles
Blocking Assay:Article Title: Cytoplasmic and nuclear NFATc3 cooperatively contributes to vascular smooth muscle cell dysfunction and drives aortic aneurysm and dissection Article Snippet: Lysates containing equal amounts of total protein were subjected to 6%–12% sodium dodecyl sulfate–PAGE (SDS–PAGE) and transferred onto polyvinylidene fluoride membranes (Millipore, Burlington, MA, USA). .. The membranes were blocked using a blocking reagent [Tris-buffered saline with 5% ( w / v ) non-fat dry milk and 0.1% ( v / v ) Tween 20, pH 7.4] for 1 h at room temperature and then incubated with the following primary antibodies at 4 °C overnight: anti-NFATc3 (#4998; 1:1000), anti-lamin B1 (#13435; 1:1000), anti-phospho-eEF2 (Thr56) (#2331; 1:1000), anti-eEF2 (#2332; 1:1000), Saline:Article Title: Cytoplasmic and nuclear NFATc3 cooperatively contributes to vascular smooth muscle cell dysfunction and drives aortic aneurysm and dissection Article Snippet: Lysates containing equal amounts of total protein were subjected to 6%–12% sodium dodecyl sulfate–PAGE (SDS–PAGE) and transferred onto polyvinylidene fluoride membranes (Millipore, Burlington, MA, USA). .. The membranes were blocked using a blocking reagent [Tris-buffered saline with 5% ( w / v ) non-fat dry milk and 0.1% ( v / v ) Tween 20, pH 7.4] for 1 h at room temperature and then incubated with the following primary antibodies at 4 °C overnight: anti-NFATc3 (#4998; 1:1000), anti-lamin B1 (#13435; 1:1000), anti-phospho-eEF2 (Thr56) (#2331; 1:1000), anti-eEF2 (#2332; 1:1000), Incubation:Article Title: Cytoplasmic and nuclear NFATc3 cooperatively contributes to vascular smooth muscle cell dysfunction and drives aortic aneurysm and dissection Article Snippet: Lysates containing equal amounts of total protein were subjected to 6%–12% sodium dodecyl sulfate–PAGE (SDS–PAGE) and transferred onto polyvinylidene fluoride membranes (Millipore, Burlington, MA, USA). .. The membranes were blocked using a blocking reagent [Tris-buffered saline with 5% ( w / v ) non-fat dry milk and 0.1% ( v / v ) Tween 20, pH 7.4] for 1 h at room temperature and then incubated with the following primary antibodies at 4 °C overnight: anti-NFATc3 (#4998; 1:1000), anti-lamin B1 (#13435; 1:1000), anti-phospho-eEF2 (Thr56) (#2331; 1:1000), anti-eEF2 (#2332; 1:1000), Article Title: Licochalcone A suppresses pancreatic ductal adenocarcinoma progression by targeting eEF2K-mediated pyroptosis Article Snippet: .. The samples were cryogenically sliced (5 μM) and incubated with primary antibodies, including Article Title: Overactive Neuronal eEF2K/eEF2 signaling is associated with cognitive impairment and apathy-like behavior. Article Snippet: .. Blots were incubated with the following primary antibodies overnight at 4 °C: Transfection:Article Title: MiR 329/449 Suppresses Cell Proliferation, Migration and Synergistically Sensitizes GBM to TMZ by Inhibiting Src/FAK, NF-kB, and Cyclin D1 Activity. Article Snippet: MiR Control (inert, non-complementary sequence), MiR-329-3p (AACACACCUGGUUAACCUCUUU) and miR-449b-5p (AGGCAGUGUAUUGUUAGCUGGC) were purchased from Thermo Fisher Scientific (Waltham, MA, USA). .. HiPerFect Transfection reagent was purchased from Qiagen (Germantown, MD, USA). Article Title: MiR 329/449 Suppresses Cell Proliferation, Migration and Synergistically Sensitizes GBM to TMZ by Inhibiting Src/FAK, NF-kB, and Cyclin D1 Activity Article Snippet: MiR Control (inert, non-complementary sequence), MiR-329-3p (AACACACCUGGUUAACCUCUUU) and miR-449b-5p (AGGCAGUGUAUUGUUAGCUGGC) were purchased from Thermo Fisher Scientific (Waltham, MA, USA). .. HiPerFect Transfection reagent was purchased from Qiagen (Germantown, MD, USA). other:Article Title: Licochalcone A suppresses pancreatic ductal adenocarcinoma progression by targeting eEF2K-mediated pyroptosis Article Snippet: |